View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18974_low_129 (Length: 214)
Name: NF18974_low_129
Description: NF18974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18974_low_129 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 214
Target Start/End: Original strand, 13023610 - 13023806
Alignment:
| Q |
18 |
gatgatgcagaggaatttagacctgaaagatggcttgatgaaaatggaatttttcagccagaatgccctttcaagtttacggcttttcaggttagtagaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13023610 |
gatgatgcagaggaatttagacctgaaagatggcttgatgaaaatggaatttttcagccagaatgccctttcaagtttacggcttttcaggttagtagaa |
13023709 |
T |
|
| Q |
118 |
tttttctatatggacatctagcttttgtttattctctataatatatttaggtaaatgatcattataggcgggtgtttgttgattttcctacaatgat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
13023710 |
tttttctatatggacatctagcttttgtttattctctataatatatttaggtaaatgatcattataggcgggtgtttgttgattttccaacaatgat |
13023806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 18 - 127
Target Start/End: Complemental strand, 13070312 - 13070203
Alignment:
| Q |
18 |
gatgatgcagaggaatttagacctgaaagatggcttgatgaaaatggaatttttcagccagaatgccctttcaagtttacggcttttcaggttagtagaa |
117 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||||||||||| | ||||||| |||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13070312 |
gatgatgcagaggaatttagacctgcaagatggctggatgaaaatggcaattttcaggcagagaaccctttcaagtttactgcttttcaggttagtagaa |
13070213 |
T |
|
| Q |
118 |
tttttctata |
127 |
Q |
| |
|
|||||||||| |
|
|
| T |
13070212 |
tttttctata |
13070203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 21 - 109
Target Start/End: Original strand, 46160205 - 46160293
Alignment:
| Q |
21 |
gatgcagaggaatttagacctgaaagatggcttgatgaaaatggaatttttcagccagaatgccctttcaagtttacggcttttcaggt |
109 |
Q |
| |
|
||||| ||| |||| ||||| || |||||||||||||||||||||| ||||||| |||| ||||||| ||||| || || |||||||| |
|
|
| T |
46160205 |
gatgctgagcaattcagaccagagagatggcttgatgaaaatggaaattttcagagagaaagcccttttaagttcacagcctttcaggt |
46160293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 21 - 73
Target Start/End: Original strand, 46167067 - 46167119
Alignment:
| Q |
21 |
gatgcagaggaatttagacctgaaagatggcttgatgaaaatggaatttttca |
73 |
Q |
| |
|
||||| ||| |||| ||||| || |||||||||||||||||||||| |||||| |
|
|
| T |
46167067 |
gatgctgagcaattcagaccagagagatggcttgatgaaaatggaaattttca |
46167119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University