View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18974_low_130 (Length: 214)

Name: NF18974_low_130
Description: NF18974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18974_low_130
NF18974_low_130
[»] chr8 (1 HSPs)
chr8 (16-196)||(28460819-28460999)
[»] chr6 (1 HSPs)
chr6 (25-95)||(7071468-7071538)
[»] chr2 (1 HSPs)
chr2 (72-110)||(39811356-39811394)
[»] chr3 (1 HSPs)
chr3 (51-87)||(7030742-7030778)


Alignment Details
Target: chr8 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 16 - 196
Target Start/End: Complemental strand, 28460999 - 28460819
Alignment:
16 gttttcgggaaggcgaaagtaaagtcttttaggttgctcaaatctaagttttgtcatttatcttttgatttgcatgtttgattgataaatcccttctttt 115  Q
    ||||| || |||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||| |||||||||||||||||    
28460999 gttttgggtaaggtgaaagtaaagtcttttaggttgctcaaatctaaattttgtcatttatcttttgatttgtatgtttgatagataaatcccttctttt 28460900  T
116 gtcttgggatgcctactacttagtgttttctttggtccgtttagccggtttggctttgtgattcttgtgtttgaccttttc 196  Q
    ||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||    
28460899 gtcttgggatgcctactacttagtgttttctttagtccttttagccggtttggctttgtgattcttgtgtttgaccttttc 28460819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 95
Target Start/End: Original strand, 7071468 - 7071538
Alignment:
25 aaggcgaaagtaaagtcttttaggttgctcaaatctaagttttgtcatttatcttttgatttgcatgtttg 95  Q
    |||| |||||||| |  |||| ||| |||||||  |||||||||| |||||||||||||||| ||||||||    
7071468 aaggtgaaagtaatgaatttttggtggctcaaagataagttttgtgatttatcttttgatttacatgtttg 7071538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 72 - 110
Target Start/End: Original strand, 39811356 - 39811394
Alignment:
72 tttatcttttgatttgcatgtttgattgataaatccctt 110  Q
    ||||||||||||||||||||| |||| ||||||||||||    
39811356 tttatcttttgatttgcatgtctgatggataaatccctt 39811394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 51 - 87
Target Start/End: Complemental strand, 7030778 - 7030742
Alignment:
51 gctcaaatctaagttttgtcatttatcttttgatttg 87  Q
    ||||||| ||||||||||| |||||||||||||||||    
7030778 gctcaaaactaagttttgtaatttatcttttgatttg 7030742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University