View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18974_low_134 (Length: 205)
Name: NF18974_low_134
Description: NF18974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18974_low_134 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 4e-43; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 16 - 127
Target Start/End: Original strand, 42091477 - 42091589
Alignment:
| Q |
16 |
aatatgcaatatcaagaaacactgaattgtactcatcagtattctaacgcctcaacatactaagtataattcatattttagtacaaaacagccactactc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | |||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42091477 |
aatatgcaatatcaagaaacactgaattgtactcatccggattctaacacctcaacatactaagtataattgatattttagtacaaaacagccactactc |
42091576 |
T |
 |
| Q |
116 |
at-cattttggta |
127 |
Q |
| |
|
|| |||||||||| |
|
|
| T |
42091577 |
atccattttggta |
42091589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 128 - 190
Target Start/End: Original strand, 42091665 - 42091727
Alignment:
| Q |
128 |
atcaggacaaaacaccaacaataaaaaggaccttctgatgcgtgagtagaacagaaaaataac |
190 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42091665 |
atcaggacaaaacaccaacaacaaaaaggaccttgtgatgcgtgagtagaacagaaaaataac |
42091727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University