View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18974_low_27 (Length: 481)
Name: NF18974_low_27
Description: NF18974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18974_low_27 |
 |  |
|
| [»] scaffold0683 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0683 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 1)
Name: scaffold0683
Description:
Target: scaffold0683; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 427 - 475
Target Start/End: Original strand, 4866 - 4914
Alignment:
| Q |
427 |
tgatacatatagtgtgaggaagagccatgttaaggaaaatctgatgatg |
475 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
4866 |
tgatacatatagtgtgaggaagagccatgtcaaggaaaatcttatgatg |
4914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University