View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18974_low_49 (Length: 387)
Name: NF18974_low_49
Description: NF18974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18974_low_49 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 20 - 369
Target Start/End: Complemental strand, 21411296 - 21410947
Alignment:
| Q |
20 |
gccacgtataaattgctaccggaaaattagggtccaaatagaggtttggtaaatgatgccaaaactccaataattggtttttgtctttcccattttggtc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21411296 |
gccacgtataaattgctaccggaaaattagggtccaaatagaggtttggtaaatgatgccaaaactccaataattggtttttgtctttcccattttggtc |
21411197 |
T |
 |
| Q |
120 |
atcaacatgacttaaccagaacccttgttgtcacattcatacacatgtttgagtagtttagtcattcatcttgttctacatggttcgtcacatcaacctt |
219 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21411196 |
atcaacatgactcaaccagaacccttgttgtcacattcatacacatgtttgagtagtttagtcattcatcttgttctacatggttcgtcacatcaacctt |
21411097 |
T |
 |
| Q |
220 |
ccatcctcagaatttatttattttt--aagnnnnnnntatcatgaaataagttaaaaagacaggaaataatttcatgcgacaactgttacagtttctcga |
317 |
Q |
| |
|
||||||||||| ||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
21411096 |
ccatcctcaga-tttatttatttttttaagaaaaaaatatcatgaaataagttaaaaagacaggaaataatttcatgcgacag-tgttacagtttctcga |
21410999 |
T |
 |
| Q |
318 |
tcgtttgtccattgaaatttagcccccataacgggataggatgtctccatgg |
369 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21410998 |
tcgtttgtccattgaaatttagcccccataacgggataggatgtctccatgg |
21410947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University