View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18974_low_54 (Length: 370)
Name: NF18974_low_54
Description: NF18974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18974_low_54 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 1 - 362
Target Start/End: Complemental strand, 38096532 - 38096171
Alignment:
| Q |
1 |
cccacattgctcagcctcccttcttgctgctttgctttcatctctgcacctgaacttccacacgctatcagctgcagcaaaacagagtaacgactcgacg |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38096532 |
cccacattgctcagcctcccttcctgctgctttgctttcatctctgcacctgaacttccacacgctatcagctgcagcaaaacagagtaacgactcgacg |
38096433 |
T |
|
| Q |
101 |
tagtcgatggtgccgacgtcgttggatagttactatctttgacattgttgacccttctttcttctctttgtttcagtttctcagcaagggtagtagtgga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38096432 |
tagtcgatggtgccgacgtcgttggatagttattatctttgacattgttgacccttctttcttctctttgtttcagtttctcagcaagggtagtagtgga |
38096333 |
T |
|
| Q |
201 |
atttgttgtaggannnnnnnnnnnnnnnnnnnnnntagttataactatctcatcaagttcttctgttgaaacacctcttgagcaacgagaatgaggtgtt |
300 |
Q |
| |
|
||||||||||| | |||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38096332 |
atttgttgtagaaggtggtggtggttgtggtgggttagttataactatctcgtcgagttcttctgttgaaacacctcttgagcaacgagaatgaggtgtt |
38096233 |
T |
|
| Q |
301 |
gttgttgaacttgtgtaacttgttttctctccatctcctaataattcctcttcatattcttc |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38096232 |
gttgttgaacttgtgtaacttgttttctctccatctcctaataattcctcttcatattcttc |
38096171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University