View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18974_low_64 (Length: 351)
Name: NF18974_low_64
Description: NF18974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18974_low_64 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 19 - 224
Target Start/End: Original strand, 39247000 - 39247205
Alignment:
| Q |
19 |
ctgatgccactcacgaggatgcaaatcaacatagattatcaccagggggaccagatcctcatcatcatgcaggtccacaaaacaagtagctatatatata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39247000 |
ctgatgccactcacgaggatgcaaatcaacatagattatcaccagggggaccagatcctcatcatcatgcaggtccacaaaacaagtagctatatatata |
39247099 |
T |
 |
| Q |
119 |
actctctcgttatataatagaaatattttccaaaaagttgggtagtcaacttatcagttatcagccaccgttgatttgttggtatgtcttaagaacagaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
39247100 |
actctctcgttatataatagaaatattttccaaaaagttgggtagtcaacttatcagttatcagccactgttgatttgttggtatgtcttaagaacagaa |
39247199 |
T |
 |
| Q |
219 |
ctagta |
224 |
Q |
| |
|
|||||| |
|
|
| T |
39247200 |
ctagta |
39247205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 299 - 349
Target Start/End: Original strand, 39247280 - 39247330
Alignment:
| Q |
299 |
agtgagaaagaagattaagtgcgaggattatgtttttgtaatgtagttcat |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39247280 |
agtgagaaagaagattaagtgcgaggattatgtttttgtaatgtagttcat |
39247330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University