View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18974_low_79 (Length: 308)
Name: NF18974_low_79
Description: NF18974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18974_low_79 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 127 - 293
Target Start/End: Original strand, 5719182 - 5719343
Alignment:
| Q |
127 |
ggttgttttaatttagctttaacttcaccacaccaaaacatgtctgaggagtttcttgaatccgaggttcnnnnnnncaaccagattcatcaatctgaag |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5719182 |
ggttgttttaatttagctttaacttcacca-----aaacatgtctgaggagtttcttgaatccgaggttctttttttcaaccagattcatcaatctgaag |
5719276 |
T |
|
| Q |
227 |
ctgaagacaagaaggtgctgatgaagctgaagaaggaggagatcaattctgatgatgaaattgatca |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5719277 |
ctgaagacaagaaggtgctgatgaagctgaagaaggaggagatcaattctgatgatgaaattgatca |
5719343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 5719056 - 5719143
Alignment:
| Q |
1 |
aattataatcttttctaataattttcccccttttctgttttctataaattcaactccaagcctccaaacctattcactgtttcattcc |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5719056 |
aattataatcttttctaataattttcccccttttctgttttctataaattcaactccaagcctccaaacctattcactgtttcattcc |
5719143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University