View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18974_low_83 (Length: 297)
Name: NF18974_low_83
Description: NF18974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18974_low_83 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 19 - 287
Target Start/End: Original strand, 29882740 - 29883008
Alignment:
| Q |
19 |
aaaatgaaggattatccatatccaaatgtaaagttcaaatttgcaaagaaggatcatcatcaaatatttttattctttaatttgagaaaaatgttgaaac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29882740 |
aaaatgaaggattatccatatccaaatgtaaagttcaaatttgcaaagagggatcatcatcaaatatttttattctttaatttgagaaaaatgttgaaac |
29882839 |
T |
 |
| Q |
119 |
attcgtctgagtcagaaaagtcatacatagcttttgaacaatatggtcacagaatttatccatgttatagaattgagcatctcgaattatatccgatacc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29882840 |
attcgtctgagtcagaaaagtcatacatagcttttgaacaatatggtcacagaatttatccatgttatagaattgagcatctcgaattatatccgatacc |
29882939 |
T |
 |
| Q |
219 |
tatgttttcctgaacatgtgcagaggaatatcatagaagcatcatcatcaaagttgccacttgcctttg |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29882940 |
tatgttttcctgaacatgtgcagaggaatatcatagaagcatcatcatcaaagttgccacttgcctttg |
29883008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University