View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18974_low_86 (Length: 290)
Name: NF18974_low_86
Description: NF18974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18974_low_86 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 99; Significance: 7e-49; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 13887935 - 13888037
Alignment:
| Q |
1 |
ttacttctctcattttgagtttcttattatggtatcagaagccttctctttggagaaggtggttacgattaagttacgcatcatttccgccatggatgcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
13887935 |
ttacttctctcattttgagtttcttattatggtatcagaagccttctctttggagaaggtggttacgattaagttacgcatcatttccgcaatggatgcg |
13888034 |
T |
|
| Q |
101 |
tga |
103 |
Q |
| |
|
||| |
|
|
| T |
13888035 |
tga |
13888037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 198 - 274
Target Start/End: Original strand, 13888135 - 13888211
Alignment:
| Q |
198 |
gtgttgattcctgaatcttccattcnnnnnnnattcttcaccgatcaaatgatggtacataatcaagatccaacaca |
274 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
13888135 |
gtgttgattcctgaatcttccattctttttttattcttcaccgatcaaatgatggtgcgtaatcaagatccaacaca |
13888211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 11021606 - 11021525
Alignment:
| Q |
20 |
tttcttattatggtatcagaagccttctctttggagaaggtggttacgattaagttacgcatcatttccgccatggatgcgt |
101 |
Q |
| |
|
||||||| |||||||||||||| |||||||| |||||||| ||||||||| |||||||| || ||||||||||||||||| |
|
|
| T |
11021606 |
tttcttaatatggtatcagaagtcttctcttgagagaaggttgttacgattcagttacgcttctcttccgccatggatgcgt |
11021525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 29
Target Start/End: Original strand, 13892591 - 13892619
Alignment:
| Q |
1 |
ttacttctctcattttgagtttcttatta |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
13892591 |
ttacttctctcattttgagtttcttatta |
13892619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 14 - 103
Target Start/End: Original strand, 15094995 - 15095084
Alignment:
| Q |
14 |
tttgagtttcttattatggtatcagaagccttctctttggagaaggtggttacgattaagttacgcatcatttccgccatggatgcgtga |
103 |
Q |
| |
|
||||||||| |||||| |||||| ||||||||||||| | |||||||||| |||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
15094995 |
tttgagtttgttattagggtatccgaagccttctcttggtagaaggtggtcacgattcagttacgcatcatttccgcaatggatgcgtga |
15095084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University