View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18974_low_93 (Length: 271)
Name: NF18974_low_93
Description: NF18974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18974_low_93 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 43961614 - 43961362
Alignment:
| Q |
1 |
cacataaaaaattggtcaagaataaagttcaaggggattcacttgaatccactagattggttgtggctctgcgaccggtttcttattgggattttgctga |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |||||||||| |
|
|
| T |
43961614 |
cacataaaaaattggtcaagaataaaattcaaggggattcacttgaatccactagattggttgtggctccgccaccggtttcttattggaattttgctga |
43961515 |
T |
|
| Q |
101 |
gatacaatatgcaagataaaagatgaagagtgacaatcactacaatgagaaagggggagttgaaaaaagagagggaaccattaccgtccaagtttgtttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43961514 |
gatacaatatgcaagataaaagatgaagagtgacaatcagtacaatgagaaagggggagttgaaaaaagagagggaaccattactgtccaagtttgtttt |
43961415 |
T |
|
| Q |
201 |
tgtgattattttttggaagattaaccaatatgagagttcttagatggcataac |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43961414 |
tgtgattattttttggaagattaaccaatatgagagttcttagatggcataac |
43961362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University