View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18974_low_96 (Length: 259)
Name: NF18974_low_96
Description: NF18974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18974_low_96 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 20 - 132
Target Start/End: Original strand, 7968820 - 7968930
Alignment:
| Q |
20 |
tatttccccaaaataaatattattattttttgaagaataaattattttctatatgaaacgaagataaattattttctgtgtgtgtagatgatggaaaagt |
119 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
7968820 |
tatttcccctaaaaaaatattattattttttgaagaataaattattttctgtatgaaacgaagataaattattttc--tgtgcgtagatgatggaaaagt |
7968917 |
T |
 |
| Q |
120 |
ctttgtatatata |
132 |
Q |
| |
|
||||||||||||| |
|
|
| T |
7968918 |
ctttgtatatata |
7968930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University