View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18975_high_8 (Length: 205)
Name: NF18975_high_8
Description: NF18975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18975_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 8 - 186
Target Start/End: Original strand, 5621723 - 5621901
Alignment:
| Q |
8 |
ggtagattatactatatgaactactatttctgcagagatattacagtaattagaaaatgaaatttgaatatgtatttatgaaggattgtagtaaacactt |
107 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5621723 |
ggtaaattgtactatatgaactactatttctgctgagatattacagtaattagcaaatgaaatttgaatatgtatttatgaaggattgtagtaaacactt |
5621822 |
T |
|
| Q |
108 |
tgagtctgttggtgttgctgttatattggtgtctattgcgatgttgttccttaaaaaagtattactaatctgctacttg |
186 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
5621823 |
tgagtctgttggcgttgctgttatattggtgtctattgcgatgttgttccttaaaagagtattgctaatctgctacttg |
5621901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University