View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18975_low_7 (Length: 222)
Name: NF18975_low_7
Description: NF18975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18975_low_7 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 5 - 222
Target Start/End: Original strand, 40546601 - 40546818
Alignment:
| Q |
5 |
caaatgcaaattgaagatatatatgaagtattaaataaaagttttgagcctattggtgttgctgttatattgatgtgcttaattgagcaatactaaaatc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40546601 |
caaatgcaaattgaagatatatatgaagtattaaataaaaattttgagcctattggtgttgctgttatattgatgtgcttaattgagcaatactaaaatc |
40546700 |
T |
 |
| Q |
105 |
tagtatgtagtgaaaatttctatttgggtgtgggtgcagacatattcacaccggatctactattcaggctttcaaatttctactagtatttgtgatcttg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40546701 |
tagtatgtagtgaaaatttctatttgggtgtgggtgcagacatattcacaccaaatctactattcaggctttcaaatttctactagtatttgtgatctta |
40546800 |
T |
 |
| Q |
205 |
tgttgcaggctgataata |
222 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
40546801 |
tgttgcaggctgataata |
40546818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University