View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18975_low_8 (Length: 205)

Name: NF18975_low_8
Description: NF18975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18975_low_8
NF18975_low_8
[»] chr1 (1 HSPs)
chr1 (8-186)||(5621723-5621901)


Alignment Details
Target: chr1 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 8 - 186
Target Start/End: Original strand, 5621723 - 5621901
Alignment:
8 ggtagattatactatatgaactactatttctgcagagatattacagtaattagaaaatgaaatttgaatatgtatttatgaaggattgtagtaaacactt 107  Q
    |||| ||| |||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
5621723 ggtaaattgtactatatgaactactatttctgctgagatattacagtaattagcaaatgaaatttgaatatgtatttatgaaggattgtagtaaacactt 5621822  T
108 tgagtctgttggtgttgctgttatattggtgtctattgcgatgttgttccttaaaaaagtattactaatctgctacttg 186  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||    
5621823 tgagtctgttggcgttgctgttatattggtgtctattgcgatgttgttccttaaaagagtattgctaatctgctacttg 5621901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University