View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18977_high_12 (Length: 227)
Name: NF18977_high_12
Description: NF18977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18977_high_12 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 66 - 227
Target Start/End: Original strand, 13446819 - 13446980
Alignment:
| Q |
66 |
caaaatatgagcaaagtcggtctaaatccaaagaagatattcctcatgctttaaattgatatcttgatgatcttattcatcaatactatcaaattattag |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
13446819 |
caaaatatgagcaaagtcggtctaaatccaaagaagatattcctcatgctttaaattgatatcttgatgatcttattcatcaatactatcaaattattgg |
13446918 |
T |
 |
| Q |
166 |
ctattagggcagaaattaacaaacaaaaaagatgtcaataacaaatgatgcataccttctcc |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13446919 |
ctattagggcagaaattaacaaacaaaaaagatgtcaataacaaatgatgcataccttctcc |
13446980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University