View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18977_high_5 (Length: 308)

Name: NF18977_high_5
Description: NF18977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18977_high_5
NF18977_high_5
[»] chr3 (1 HSPs)
chr3 (21-298)||(37632627-37632905)
[»] chr1 (2 HSPs)
chr1 (23-160)||(28697333-28697470)
chr1 (24-148)||(45220501-45220624)


Alignment Details
Target: chr3 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 21 - 298
Target Start/End: Complemental strand, 37632905 - 37632627
Alignment:
21 tgaggttcatgtattcgtgggttagcaacatgtttttggtctgtatggctactctctggcaggcaatttttgggttatctttgtatgccttgtcattggt 120  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
37632905 tgaggttcatgtattcgtgggttagcaacatgtttttggtttgtatggctactctctggcaggcaattttggggttatctttgtatgccttgtcattggt 37632806  T
121 gtatgactttgtatggtgtattgtccccc-ttcgagcacatatagtggaagccttttccaacccttcatagaaggtgggtagaggtatcttgttgtgatg 219  Q
    |||||||| |||||||||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||||||||||| ||||||||| |||||    
37632805 gtatgactgtgtatggtgtattgtccccccttcgagcacatatagtgtaagccctttccaacccttcatagaaggtgggtagagttatcttgttatgatg 37632706  T
220 cttgcggcagagtttttaatattttaattcatcgagaaaaacaacaaaaatgaagaagtatgaattgcatgtagaataa 298  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
37632705 cttgcggcagagtttttaatattttaattcatcgagaaaaacaacaaaaatgcagaagtatgaattgcatgtagaataa 37632627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 23 - 160
Target Start/End: Complemental strand, 28697470 - 28697333
Alignment:
23 aggttcatgtattcgtgggttagcaacatgtttttggtctgtatggctactctctggcaggcaatttttgggttatctttgtatgccttgtcattggtgt 122  Q
    |||||| |||||| |||  |||||||| |||||||||||||||| ||  |||| |||| || ||| |  | ||||||||||||||||||| |||||||||    
28697470 aggttcttgtattggtgaattagcaacctgtttttggtctgtatagcatctctttggcgggtaatatcggtgttatctttgtatgccttgccattggtgt 28697371  T
123 atgactttgtatggtgtattgtcccccttcgagcacat 160  Q
    ||| ||||||||| | |||||| | ||||||| |||||    
28697370 atgtctttgtatgatctattgtacaccttcgaacacat 28697333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 24 - 148
Target Start/End: Complemental strand, 45220624 - 45220501
Alignment:
24 ggttcatgtattcgtgggttagcaacatgtttttggtctgtatggctactctctggcaggcaatttttgggttatctttgtatgccttgtcattggtgta 123  Q
    |||||||||||| ||| ||||||||| |||||||||| ||||||||   ||| ||| ||| |||||| | ||| | ||||     |||| ||||||| ||    
45220624 ggttcatgtattggtgagttagcaacctgtttttggtttgtatggcatgtctttggtaggaaattttggtgttttatttgctcagcttgccattggt-ta 45220526  T
124 tgactttgtatggtgtattgtcccc 148  Q
    ||||||||| |||||||||||||||    
45220525 tgactttgtgtggtgtattgtcccc 45220501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University