View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18977_high_6 (Length: 303)
Name: NF18977_high_6
Description: NF18977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18977_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 18 - 293
Target Start/End: Complemental strand, 32771788 - 32771513
Alignment:
| Q |
18 |
atgtctgttgaataagatacctttataacagctataccgccagtgagtttcgcaattctctctaagagctttctcgaatggtttgcattgtctgtttcaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32771788 |
atgtctgttgaataagatacctttataacagctataccgccagtgagtttcgcaattctctctgagagctttctcgaatggtttgcattgtctgtttcaa |
32771689 |
T |
|
| Q |
118 |
taagatctttctttatctgtaaaattctagcctgaatttcagccttagtgtttggatcagcaaatatagttgttgcattgctggttattttcactttcag |
217 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32771688 |
taagatccttctttatctgtaaaattctagcctgaatttcagccttagtgtttggatcagcaaatatagttgttgcattgctggttattttcactttcag |
32771589 |
T |
|
| Q |
218 |
tgcagaaccaagctggtctgatgttgtaccttcaagtgtaagacccaaatctccacagagaaaatccgcacctatg |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32771588 |
tgcagaaccaagctggtctgatgttgtaccttcaagtgtaagacccaaatctccacagagaaaatccgcacctatg |
32771513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University