View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18977_low_13 (Length: 227)
Name: NF18977_low_13
Description: NF18977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18977_low_13 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 6 - 227
Target Start/End: Original strand, 35625223 - 35625444
Alignment:
| Q |
6 |
ataataattgttgtactcaaaactcaaatcccttttcaccagccacaagtctccctctaatgacttcacaagataacctttaaaggttccacgaaaaaca |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35625223 |
ataataattgttgtactcaaaactcaaatcccttttcaccagccacaagtctccctctaatgacttcacaagataacctttaaaggttccatgaaaaaca |
35625322 |
T |
 |
| Q |
106 |
acgttgttggttggaattatcgtcacgccatacgggttgtctaaatcaagattgaaggacactataccgcgacagtgacttacaccatatactaaacctt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
35625323 |
acgttgttggttggaattatcgtcacgccataagggtcgtctaaatcaagattgaaggacactataccgcgacagtgacttacaccatatactaaatctt |
35625422 |
T |
 |
| Q |
206 |
tgtagaacataacatccataaa |
227 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
35625423 |
tgtagaacataacatccataaa |
35625444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 37 - 102
Target Start/End: Original strand, 35628963 - 35629028
Alignment:
| Q |
37 |
cttttcaccagccacaagtctccctctaatgacttcacaagataacctttaaaggttccacgaaaa |
102 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||||||||||||||||| ||||| ||||| |
|
|
| T |
35628963 |
cttttcaccatccacaagtctccctctaatgatttcacaagataacctttaaaccttccatgaaaa |
35629028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University