View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18977_low_5 (Length: 308)
Name: NF18977_low_5
Description: NF18977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18977_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 21 - 298
Target Start/End: Complemental strand, 37632905 - 37632627
Alignment:
| Q |
21 |
tgaggttcatgtattcgtgggttagcaacatgtttttggtctgtatggctactctctggcaggcaatttttgggttatctttgtatgccttgtcattggt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37632905 |
tgaggttcatgtattcgtgggttagcaacatgtttttggtttgtatggctactctctggcaggcaattttggggttatctttgtatgccttgtcattggt |
37632806 |
T |
 |
| Q |
121 |
gtatgactttgtatggtgtattgtccccc-ttcgagcacatatagtggaagccttttccaacccttcatagaaggtgggtagaggtatcttgttgtgatg |
219 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
37632805 |
gtatgactgtgtatggtgtattgtccccccttcgagcacatatagtgtaagccctttccaacccttcatagaaggtgggtagagttatcttgttatgatg |
37632706 |
T |
 |
| Q |
220 |
cttgcggcagagtttttaatattttaattcatcgagaaaaacaacaaaaatgaagaagtatgaattgcatgtagaataa |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37632705 |
cttgcggcagagtttttaatattttaattcatcgagaaaaacaacaaaaatgcagaagtatgaattgcatgtagaataa |
37632627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 23 - 160
Target Start/End: Complemental strand, 28697470 - 28697333
Alignment:
| Q |
23 |
aggttcatgtattcgtgggttagcaacatgtttttggtctgtatggctactctctggcaggcaatttttgggttatctttgtatgccttgtcattggtgt |
122 |
Q |
| |
|
|||||| |||||| ||| |||||||| |||||||||||||||| || |||| |||| || ||| | | ||||||||||||||||||| ||||||||| |
|
|
| T |
28697470 |
aggttcttgtattggtgaattagcaacctgtttttggtctgtatagcatctctttggcgggtaatatcggtgttatctttgtatgccttgccattggtgt |
28697371 |
T |
 |
| Q |
123 |
atgactttgtatggtgtattgtcccccttcgagcacat |
160 |
Q |
| |
|
||| ||||||||| | |||||| | ||||||| ||||| |
|
|
| T |
28697370 |
atgtctttgtatgatctattgtacaccttcgaacacat |
28697333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 24 - 148
Target Start/End: Complemental strand, 45220624 - 45220501
Alignment:
| Q |
24 |
ggttcatgtattcgtgggttagcaacatgtttttggtctgtatggctactctctggcaggcaatttttgggttatctttgtatgccttgtcattggtgta |
123 |
Q |
| |
|
|||||||||||| ||| ||||||||| |||||||||| |||||||| ||| ||| ||| |||||| | ||| | |||| |||| ||||||| || |
|
|
| T |
45220624 |
ggttcatgtattggtgagttagcaacctgtttttggtttgtatggcatgtctttggtaggaaattttggtgttttatttgctcagcttgccattggt-ta |
45220526 |
T |
 |
| Q |
124 |
tgactttgtatggtgtattgtcccc |
148 |
Q |
| |
|
||||||||| ||||||||||||||| |
|
|
| T |
45220525 |
tgactttgtgtggtgtattgtcccc |
45220501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University