View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18977_low_8 (Length: 267)
Name: NF18977_low_8
Description: NF18977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18977_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 5 - 249
Target Start/End: Complemental strand, 21283075 - 21282831
Alignment:
| Q |
5 |
gaggagcagagagagaattatgagaaaggtctaagaagatgagtttgttagtgaaaagtgatgaaggaatagttttactgaagttgttgtttgagagttg |
104 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
21283075 |
gaggaccagaaagagaattatgagaaaggtctaagaagatgagtttgttagtgaaaagtgatgaaggaatagttttagtgaaattgttgtttgagagttg |
21282976 |
T |
|
| Q |
105 |
aagggtagtgagttcagttaagtggcctagctcggaagggatgtatcctgttagagattttgaaacgagggtgatttgagtgacttgttcgtttgtgcat |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
21282975 |
aagggtagtgagttcagttaagtggcctagctcggaagggatgtatcctgttagagattttgaaacgagggtgatttgagtgacttgcttgtttgtgcat |
21282876 |
T |
|
| Q |
205 |
gatattcctttccatgagcaaggtgtgggaagtgagtctgagtct |
249 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
21282875 |
gatattccttcccatgagcaaggtgtgggaagtgagtctgagtct |
21282831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University