View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18978_high_10 (Length: 311)
Name: NF18978_high_10
Description: NF18978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18978_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 1 - 294
Target Start/End: Complemental strand, 28708442 - 28708149
Alignment:
| Q |
1 |
aaaggtcttgtgggtaaagctagatatcatatggcaaaagcatatgatcatatttagtggaaatttctcgttgttgtgttgaactctatggactcacaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28708442 |
aaaggtcttgtgggtaaagctagatatcatatggcaaaagcatatgatcatatttagtggaaatttctcgttgttgtgttgaactctatggactcacaaa |
28708343 |
T |
 |
| Q |
101 |
aatggcaaaatcttatttttagatgcatttcatcagtgtcgttttagtgatcgtaaatggtaatccttgtccaatcttttcccctcatcgtggactccat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28708342 |
aatggcaaaatcttatttttagatgcatttcatcagtgtcgttttagtgatcgtaaatggtaatccttgtccaatcttttcccctcatcgtggactccat |
28708243 |
T |
 |
| Q |
201 |
caaggggatccattatctctttacttgtttatactttgtgcagaggtgttttcacgtctactcattaaagctcaagaagagaaggacttacatg |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28708242 |
caaggggatccattatctctttacttgtttatactttgtgcagaggtgttttcacgtctactcattaaagctcaagaagagaaggacttacatg |
28708149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University