View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18978_high_11 (Length: 307)

Name: NF18978_high_11
Description: NF18978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18978_high_11
NF18978_high_11
[»] chr4 (1 HSPs)
chr4 (95-254)||(16399871-16400030)


Alignment Details
Target: chr4 (Bit Score: 144; Significance: 1e-75; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 95 - 254
Target Start/End: Complemental strand, 16400030 - 16399871
Alignment:
95 gctacaaattacgcttctgaatttttcacatcctaacgattatgcaattatgttttaagccttgtaaaatacttcaagagttagtttacaaaccctagct 194  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||    
16400030 gctacaaattacgcttctgaatttttcacatcctaacgattatgcaattatgttttaagccttgtaaaatatgtcaagagttagtttacaaaccctagct 16399931  T
195 caaacgattaaaatacaaaaataaataggtagaacgtcatgaccttaattcgaacttcca 254  Q
    |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||    
16399930 caaacgataaaaatacaaaaataaataggtagaacgtcatgaccttagttcgaacttcca 16399871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University