View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18978_high_18 (Length: 240)
Name: NF18978_high_18
Description: NF18978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18978_high_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 20 - 157
Target Start/End: Complemental strand, 42286787 - 42286650
Alignment:
| Q |
20 |
aaaaatattataaaattatagnnnnnnnaacatcaaaagaagtattcataattgaatatatatgcaccatgaaatgaagaactatgttttattgttattt |
119 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42286787 |
aaaaatattataaaattctagtttttttaacatcaaaagaagtattcataattgaatatatatgcaccatgaaatgaagaactatgttttattgttattt |
42286688 |
T |
 |
| Q |
120 |
tttccatttaaaagccacaaactcatggtaatagtagt |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42286687 |
tttccatttaaaagccacaaactcatggtaatagtagt |
42286650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 200 - 240
Target Start/End: Complemental strand, 42286607 - 42286567
Alignment:
| Q |
200 |
ccgaagtctcatatgcttttgagaataaaattggaggagac |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42286607 |
ccgaagtctcatatgcttttgagaataaaattggaggagac |
42286567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University