View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18978_high_20 (Length: 217)

Name: NF18978_high_20
Description: NF18978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18978_high_20
NF18978_high_20
[»] chr5 (1 HSPs)
chr5 (1-61)||(2708531-2708591)


Alignment Details
Target: chr5 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 2708591 - 2708531
Alignment:
1 ttgattgtgtgaacagacaatagttaatgtttagcactaatgcaaatgtttgtatattgtt 61  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
2708591 ttgattgtgtgaacagacaatagttaatgttaagcactaatgcaaatgtttgtatattgtt 2708531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University