View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18978_low_10 (Length: 327)
Name: NF18978_low_10
Description: NF18978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18978_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 17 - 317
Target Start/End: Complemental strand, 3451496 - 3451196
Alignment:
| Q |
17 |
agcaccatcgcttccaaggcgtcgatggtgttgatatggatatccctagtcacatggaagcacatgtcgtaacaaatgttcttgcgaaaaccatttgggt |
116 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3451496 |
agcaccatcgcttccaaggtgtcgatggtgttgatatggatatccctagtcacatggaagcacatgtcgtaacaaatgttcttgcgaaaaccatttgggt |
3451397 |
T |
 |
| Q |
117 |
ctttttacagctattcttttatgcatttcgaccgttgtttcttaaaccgaaacctccaggtatttgggaattcatcaacttctctgttcagattgccctt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3451396 |
ctttttacagctattcttttatgcatttcgaccgttgtttcttaaaccgaaacctccaggtatttgggaattcatcaacttctctgttcagattgccctt |
3451297 |
T |
 |
| Q |
217 |
gatgtctcaatggtttatttctggggttggaaatccttagcttatctcatacttgccacatttgttggtggaggaatgcatccaatggctggtcacttca |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3451296 |
gatgtctcaatggtttatttctggggttggaaatccttagcttatctcatacttgccacatttgttggtggaggaatgcatccaatggctggtcacttca |
3451197 |
T |
 |
| Q |
317 |
t |
317 |
Q |
| |
|
| |
|
|
| T |
3451196 |
t |
3451196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University