View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18978_low_12 (Length: 307)
Name: NF18978_low_12
Description: NF18978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18978_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 1e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 95 - 254
Target Start/End: Complemental strand, 16400030 - 16399871
Alignment:
| Q |
95 |
gctacaaattacgcttctgaatttttcacatcctaacgattatgcaattatgttttaagccttgtaaaatacttcaagagttagtttacaaaccctagct |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
16400030 |
gctacaaattacgcttctgaatttttcacatcctaacgattatgcaattatgttttaagccttgtaaaatatgtcaagagttagtttacaaaccctagct |
16399931 |
T |
 |
| Q |
195 |
caaacgattaaaatacaaaaataaataggtagaacgtcatgaccttaattcgaacttcca |
254 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
16399930 |
caaacgataaaaatacaaaaataaataggtagaacgtcatgaccttagttcgaacttcca |
16399871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University