View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18978_low_14 (Length: 259)
Name: NF18978_low_14
Description: NF18978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18978_low_14 |
 |  |
|
| [»] chr1 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 65 - 259
Target Start/End: Complemental strand, 42286431 - 42286237
Alignment:
| Q |
65 |
ttcgagaagggtgtgtgcatgttgaagttttaagtaataatgaaaataaaaataattaagctacttgcttggtgttccaggttgattccttcttttcttt |
164 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42286431 |
ttcgagaagggtgtgtgcatgttgaagctttaagtaataatgaaaataaaaataattaagctacttgcttggtgttccaggttgattccttcttttcttt |
42286332 |
T |
 |
| Q |
165 |
tgaggaactgtggttgaaggagctgaggaagtagcagaagtagtagttgattgaggatgaggatgatgatgtgttatttgactttgattttcttc |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42286331 |
tgaggaactgtggttgaaggagctgaggaagtagcagaagtagtagttgattgaggatgaggatgatgatgtgttatttgactttgattttcttc |
42286237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 42286498 - 42286453
Alignment:
| Q |
1 |
tcatgatttagggtttcattatgcttgttttttgagaaaataatac |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42286498 |
tcatgatttagggtttcattatgcttgttttttgagaaaataatac |
42286453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 126 - 173
Target Start/End: Original strand, 12805364 - 12805411
Alignment:
| Q |
126 |
tacttgcttggtgttccaggttgattccttcttttcttttgaggaact |
173 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||| || ||||||||| |
|
|
| T |
12805364 |
tacttgcatggtgttccaggttgatttcttctttttttctgaggaact |
12805411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University