View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18978_low_17 (Length: 249)
Name: NF18978_low_17
Description: NF18978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18978_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 145
Target Start/End: Original strand, 12418776 - 12418920
Alignment:
| Q |
1 |
aaaatccaaaggttcccaaaattcactcgataaaaaactatgattctccattatgatacttgtaatggtatgtgttggaaccttagttggtattggtgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12418776 |
aaaatccaaaggttcccaaaattcactcgataaaaaactatgattctccattatgatacttgtaatggtatgtgttggaaccttagttggtattggtgaa |
12418875 |
T |
 |
| Q |
101 |
aaattgaacagtaacgccaaggcttatgactttgaactgatgtga |
145 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12418876 |
aaattgaacagtaacgccaaggcttatttctttgaactgatgtga |
12418920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 144 - 244
Target Start/End: Original strand, 12419278 - 12419378
Alignment:
| Q |
144 |
gatgtgagtgacattaaagannnnnnnngtgtgcttttgtcttagtcaccaagcaaattctttggcccaagttttcttccacaattattgttcatttcag |
243 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
12419278 |
gatgtgagtgacattaaagattttttttgtgtgcttttgtcttagtcaccaagcaaattctttggcccaagttttcttccacaattattgttgatttcag |
12419377 |
T |
 |
| Q |
244 |
t |
244 |
Q |
| |
|
| |
|
|
| T |
12419378 |
t |
12419378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University