View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18978_low_5 (Length: 429)
Name: NF18978_low_5
Description: NF18978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18978_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 388; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 388; E-Value: 0
Query Start/End: Original strand, 19 - 418
Target Start/End: Complemental strand, 2178091 - 2177692
Alignment:
| Q |
19 |
gttgagttgttttatcatgagatggttaagcgggggtttaagcctgatagtgtgagttttggtattaggattgatgcttattgtaagaaagggaggtttg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2178091 |
gttgagttgttttatcatgagatggttaagcgggggtttaagcctgatagtgtgagttttggtattaggattgatgcttattgtaagaaagggaggtttg |
2177992 |
T |
|
| Q |
119 |
gtgatgctttgaggcttttggaagagatggagagtaggaagtttgttgtgtcggttgaaacgataactacgttgattcatggagcagggttggttcagaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2177991 |
gtgatgctttgaggcttttggaagagatggagagtaggaagtttgttgtgtcggttgaaacgataactacgttgattcatggagcagggttggttcagaa |
2177892 |
T |
|
| Q |
219 |
tacggggaaggcgtggcagttgtttaatgagattccgttgagaaatttggttgttgattctggtgcttataatgcgttgattacgacgttggttagaaat |
318 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2177891 |
tccggggaaggcgtggcagttgtttaatgagattccgttgagaaatttggttgttgattctggtgtttataatgcgttgattacgacgttggttagaaat |
2177792 |
T |
|
| Q |
319 |
agagatgttgtatctgcgctttcgttgatggatgagatgattgaaaagcaaattttgccggatggtgtaacttatcatacaattttcttaggattgatga |
418 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2177791 |
agagatgttgtatctgcgctttcgttgatggatgggatgattgaaaagcaaattttgccggatggtgtaacttatcatacaattttcttaggattgatga |
2177692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University