View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1897_high_5 (Length: 240)
Name: NF1897_high_5
Description: NF1897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1897_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 124 - 196
Target Start/End: Original strand, 4224229 - 4224301
Alignment:
| Q |
124 |
gttaattaaataacctttccttgactggttgtgtctttgctagatagctagcttctggaatatccagtcaatg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4224229 |
gttaattaaataacctttccttgactggttgtgtctttgctagatagctagcttctgggatatccagtcaatg |
4224301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 11 - 79
Target Start/End: Original strand, 4224120 - 4224188
Alignment:
| Q |
11 |
cagagattaatgtggccatgcatggtttgtgtgttatattatacctatatctatacgtatcattttgtg |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4224120 |
cagagattaatgtggccatgcatggtttgtgtgttatattatatctatatctatacgtatcattttgtg |
4224188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University