View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18980_low_1 (Length: 628)

Name: NF18980_low_1
Description: NF18980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18980_low_1
NF18980_low_1
[»] chr5 (4 HSPs)
chr5 (395-607)||(1515992-1516204)
chr5 (13-133)||(1516464-1516584)
chr5 (294-356)||(1516243-1516306)
chr5 (196-245)||(1516355-1516404)
[»] chr8 (1 HSPs)
chr8 (16-95)||(4198047-4198124)
[»] chr1 (1 HSPs)
chr1 (519-575)||(51917933-51917989)


Alignment Details
Target: chr5 (Bit Score: 169; Significance: 3e-90; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 169; E-Value: 3e-90
Query Start/End: Original strand, 395 - 607
Target Start/End: Complemental strand, 1516204 - 1515992
Alignment:
395 acatgtgattttggatggatactaaaagctgaaataggcttataaatatgttatgagttgcactttgtctagttaattatctcttttgtcgtcagattga 494  Q
    |||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |||| | ||||||||||||||||| |||||| |||||    
1516204 acatgtgattttggatggatactagaagttgaaataggcttataaatatgttatgagttgcattttggccagttaattatctcttttatcgtcatattga 1516105  T
495 ttatgtagctatttgggatacgtcatagagtcaaagatgtttattctattggtggttggcagctagatcaattatacacttatttatgcctcatatttgg 594  Q
    |||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||    
1516104 ttatgtagctgtttgggatacgtcatagagtcaaagatatttattctattggtggttggcacctagataaattatacacttatttatgcctcatatttgg 1516005  T
595 aagctttgatcaa 607  Q
    |||||||||||||    
1516004 aagctttgatcaa 1515992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 121; E-Value: 1e-61
Query Start/End: Original strand, 13 - 133
Target Start/End: Complemental strand, 1516584 - 1516464
Alignment:
13 agcaaagggacgtcaatgggttgagataaatcacggagtttctccgcggccatggcgaagagagaaagtgataaaccctagaaaataagcgccgttgaaa 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1516584 agcaaagggacgtcaatgggttgagataaatcacggagtttctccgcggccatggcgaagagagaaagtgataaaccctagaaaataagcgccgttgaaa 1516485  T
113 taagcgattattggaagatgt 133  Q
    |||||||||||||||||||||    
1516484 taagcgattattggaagatgt 1516464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 294 - 356
Target Start/End: Complemental strand, 1516306 - 1516243
Alignment:
294 gtgaaaaataagtgcttatcttatgataa-tgtttatgaataagttggttctagataaaataga 356  Q
    |||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||    
1516306 gtgaaaaataagtgtttatcttatgataaatgtttatgaataagttggttctagataaaataga 1516243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 196 - 245
Target Start/End: Complemental strand, 1516404 - 1516355
Alignment:
196 tttttagagttttatagtcgaaggaagaatagcttcaatttgaagcagag 245  Q
    ||||| ||||||||||||| ||||||||||||||||||||||||||||||    
1516404 tttttggagttttatagtccaaggaagaatagcttcaatttgaagcagag 1516355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 33; Significance: 0.000000004; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 16 - 95
Target Start/End: Complemental strand, 4198124 - 4198047
Alignment:
16 aaagggacgtcaatgggttgagataaatcacggagtttctccgcggccatggcgaagagagaaagtgataaaccctagaa 95  Q
    |||||||| ||||||||||| ||||||||  ||||||| |  |||||||||| |||| |||  |||||||||||||||||    
4198124 aaagggacatcaatgggttgggataaatctaggagtttgttggcggccatggtgaagggag--agtgataaaccctagaa 4198047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 33; Significance: 0.000000004; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 519 - 575
Target Start/End: Original strand, 51917933 - 51917989
Alignment:
519 atagagtcaaagatgtttattctattggtggttggcagctagatcaattatacactt 575  Q
    ||||| |||||||||| ||||||| |  ||||||||||||| |||||||||||||||    
51917933 atagaatcaaagatgtctattctacttatggttggcagctaaatcaattatacactt 51917989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University