View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18980_low_3 (Length: 414)
Name: NF18980_low_3
Description: NF18980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18980_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 88 - 396
Target Start/End: Original strand, 4109823 - 4110151
Alignment:
| Q |
88 |
gtcgataaaacacacacaacttcgacgttttgagttagagtctgatgaaatattcggtttaataaggaacaatatcattattgtcagttgagctaaatcg |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4109823 |
gtcgataaaacacacacaacttcgacgtttcgagttagagtctgaagaaatattcggtttaataagaaacaatatcattattgtcagttgagctaaatcg |
4109922 |
T |
 |
| Q |
188 |
acttttcaacttatta-----------------tttttgttgaagttgtgagtggtcaaannnnnnn-----catggcatagcatagtagactagagagt |
265 |
Q |
| |
|
|||| |||||||||| ||||| ||| ||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
4109923 |
actt--caacttattatttttgttgttatcttgttttttttggagttgtgagtggtcaaaggggggggggggcagggcatagcatagtagactagagagt |
4110020 |
T |
 |
| Q |
266 |
gtgatttgggtgtgtgtgaatgatgattctcaattgccgtttaaggaggggacacgtgttaggggagagcatctatcatcaatggttgtgactatgacaa |
365 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4110021 |
gtgatttgggtgcgtgtgaatgatgattctcaattgccgtttaaggaggggacacgtgttaggggagagcatctatcatcaatggttgtgactatgacaa |
4110120 |
T |
 |
| Q |
366 |
cgttgtttgtttggaggttttagcatgtggt |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4110121 |
cgttgtttgtttggaggttttagcatgtggt |
4110151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 12 - 45
Target Start/End: Original strand, 4109747 - 4109780
Alignment:
| Q |
12 |
atgaaatggaaattaatctcaatttcaacctcag |
45 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
4109747 |
atgaaatggaaattaatctcaatttcaacctcag |
4109780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University