View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18981_low_13 (Length: 250)
Name: NF18981_low_13
Description: NF18981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18981_low_13 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 160 - 250
Target Start/End: Complemental strand, 14536864 - 14536774
Alignment:
| Q |
160 |
catggttgatgatgattgcagcaattgagttgagtaaaggagcaattgaaggcattgagattgagttcattgatatttcaactctacctat |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14536864 |
catggttgatgatgattgcagcaattgagttgagtaaaggagcaactgaaggcattgagattgagttcattgatatttcaactctacctat |
14536774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 9 - 96
Target Start/End: Complemental strand, 14537015 - 14536928
Alignment:
| Q |
9 |
agcagagatcaaagtggcagctctttctggttccatcagaaaagtttcataccattcaggccttatccgtgctggttcgatcttcgtc |
96 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14537015 |
agcagtgatcaaagtggcagctctttctggttccatcagaaaagtttcataccattcaggccttatccgtgctggttcgatcttcgtc |
14536928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University