View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18981_low_18 (Length: 226)
Name: NF18981_low_18
Description: NF18981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18981_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 20 - 212
Target Start/End: Original strand, 10461744 - 10461936
Alignment:
| Q |
20 |
aagcaaaccttattaccttaatgttataaaaaactttaccattggagataatcggaaagttgctgtagcttccgcgctgaaacctgttattccaccagca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10461744 |
aagcaaaccttattaccttaatgttataaaaaactttaccattggagataatcggaaagttgctgtagcttccgcgctgaaacctgttattccaccagca |
10461843 |
T |
 |
| Q |
120 |
gggaacaagtatgtcaatagcgtcggggatgttgggtccaaacatatccctgagcaccgccatagcttctctcaaagtctcttcattggtctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10461844 |
gggaacaagtatgtcaatagcgtcggggatgttgggtccaaacatatccctgagcaccgccatagcttctctcaaagtctcttcattggtctg |
10461936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University