View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18981_low_6 (Length: 394)
Name: NF18981_low_6
Description: NF18981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18981_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 15 - 321
Target Start/End: Original strand, 26318957 - 26319252
Alignment:
| Q |
15 |
acaaaccaccttcactaatcaacaagtgcatcgatcatcaacgagtttatggaacttttttcaaccatttaataatttaaagtttgacatacaagaaaat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
26318957 |
acaaaccaccttcactaatcaacaagtgcatcgatcatcaacgagtttatggaacttttttcaaccatttaataatttaaaggttgacatataagaaaat |
26319056 |
T |
 |
| Q |
115 |
caaaggttgaagagaagaatcgaggaaatagatggagaagtttctcttttgtttcaaagatggtctctattatttgttgacatgtaaagtgcaattac-- |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | |||||||||| ||||||||| || |
|
|
| T |
26319057 |
caaaggttgaagagaagaatcgaggaaatagatggagaagtttctcttttgtttcaaagatgg----taagaaaggttgacatgt-aagtgcaatgacta |
26319151 |
T |
 |
| Q |
213 |
tatataacctccactaaaagtataaaatgggtcattaacctttgtctacatggcatgtcaacaaggctaactccgatacttaacaaagttcatgaccttt |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||| | | ||||||||||||||||||| || |
|
|
| T |
26319152 |
tatataacctccactaaaagtataaaatgggtcattaacctttgtccacat--------aacaaggctaactctgttgcttaacaaagttcatgaccctt |
26319243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University