View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18982_high_101 (Length: 209)
Name: NF18982_high_101
Description: NF18982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18982_high_101 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 20 - 202
Target Start/End: Complemental strand, 11350438 - 11350256
Alignment:
| Q |
20 |
ggtccagctcttcttttaacttaacaatcatgtcatccatgtacacatcaagcatgtctcatatttggtttttgaatatctcattcatcatctttggtaa |
119 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11350438 |
ggtccagttcttcttttaacttaacaatcatgtcatccatgtacacatcaagcatgtctcatattttgtttttgaatatctcattcatcatctttggtaa |
11350339 |
T |
 |
| Q |
120 |
gtggcttcggtgattttatggccgaacaacattaccttatagcaatgatttcttgtccttagtcaagaaagccctatattctt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11350338 |
gtggcttcggtgattttatggccgaacaacattaccttatagcaatgatttcttgtccttagtcaagaaagccctattttctt |
11350256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University