View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18982_high_84 (Length: 242)
Name: NF18982_high_84
Description: NF18982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18982_high_84 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 18 - 223
Target Start/End: Complemental strand, 45656945 - 45656740
Alignment:
| Q |
18 |
atatgtatgtaagcccaatattcaattttaatgctgccatagtggcactatagcaccttagcatagcggaatttgaacaaaagttannnnnnnactatcc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
45656945 |
atatgtatgtaagcccaatattcaatttgaatgctgccatagtggcactatagcaccgtagcatagcagaatttgaacaaaagttatttttttactatcc |
45656846 |
T |
 |
| Q |
118 |
gctatttaccaacattgttgattgtttttcacgtaattttctgtgtcaaactcggttagatatttagttatagaatgatttgatagaattggtttaaggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45656845 |
gctatttaccaacattgttgattgtttttcacgtaattttctgtgtcaaactcggttagatatttagttatagaatgatttgatagaattggtttaaggt |
45656746 |
T |
 |
| Q |
218 |
agttag |
223 |
Q |
| |
|
|||||| |
|
|
| T |
45656745 |
agttag |
45656740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University