View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18982_high_88 (Length: 237)
Name: NF18982_high_88
Description: NF18982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18982_high_88 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 34698674 - 34698446
Alignment:
| Q |
1 |
aaagaagcaatgaaagtaatccggacccacttaggaacattcaagttacttcaagaaaaaacaccaccaaatatcgttgacaaattcggttggtgcacct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
34698674 |
aaagaagcaatgaaagtaatccggacccacttaggaacattcaagttacttcaagaaaaaacaccaccaaatatcattgataaattcggttggtgcacct |
34698575 |
T |
 |
| Q |
101 |
gggatgcattttatttaaaagtgcatcccaaaggtgtgtgggaaggtgttaagggtcttacagagggtgggtgtcctccaggtctagtcttaatagacga |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34698574 |
gggatgcattttatttgaaagtgcatcccaaaggtgtgtgggaaggtgttaagggtcttacagagggtgggtgtcctccaggtctagtcttaatagacga |
34698475 |
T |
 |
| Q |
201 |
tggttggcaatccatttgtcatgatgatg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34698474 |
tggttggcaatccatttgtcatgatgatg |
34698446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 53 - 118
Target Start/End: Complemental strand, 43564512 - 43564447
Alignment:
| Q |
53 |
aagaaaaaacaccaccaaatatcgttgacaaattcggttggtgcacctgggatgcattttatttaa |
118 |
Q |
| |
|
|||| ||||||| ||||||| | ||||| ||||| ||||||||||| |||||||| || ||||||| |
|
|
| T |
43564512 |
aagagaaaacactaccaaatttagttgataaatttggttggtgcacttgggatgctttctatttaa |
43564447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University