View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18982_high_92 (Length: 229)
Name: NF18982_high_92
Description: NF18982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18982_high_92 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 95 - 210
Target Start/End: Complemental strand, 37636613 - 37636498
Alignment:
| Q |
95 |
attcacgagtgttttatgatttcaagtggggttctgttaatccgctttgtgtccagcttttacctttgccgacctctttttcagctggacagtacatatc |
194 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37636613 |
attcacgagtgttttatgatttcaagtgaggttctgttaatccgctttgtgtccagcttttacctttgccgacctctttttcagctggacagtacatatc |
37636514 |
T |
|
| Q |
195 |
agtgtcacacttatat |
210 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
37636513 |
agtgtcacacttatat |
37636498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 16 - 97
Target Start/End: Complemental strand, 37636726 - 37636644
Alignment:
| Q |
16 |
attattcttacatgccataaaactcgatgttttgtttttagaggagtttaatatgtgggat-caaataacacttagcaatatt |
97 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37636726 |
attattcttacatgccataaaacttgatgttttgtttttagaggagtttaatatgtgggatccaaataacacttagcaatatt |
37636644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University