View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18982_low_103 (Length: 207)
Name: NF18982_low_103
Description: NF18982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18982_low_103 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 12 - 189
Target Start/End: Complemental strand, 25365118 - 25364941
Alignment:
| Q |
12 |
gaagaatatctgataaaagctgaaaaaatgtctctgggaaatgaaagaactgcgcctaccctatagtaaagggtgattcatggtatgaacgtgagaaaag |
111 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25365118 |
gaagaaaatctgataaaagctgaaaaaatgtctctgggaaatgaaagaactgcgcctactctatagtaaagggtgattcatggtatgaacgtgagaaaag |
25365019 |
T |
 |
| Q |
112 |
gttgaacctttttgaataacacgcaaaggtgttaaaaggagagaatccaggtgaagagaaagagtagaataatgggat |
189 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25365018 |
gttgaacctttttgaagaacacgcaaaggtgttaaaaggagggaatccaggtgaagagaaaaagtagaataatgggat |
25364941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University