View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18982_low_42 (Length: 352)
Name: NF18982_low_42
Description: NF18982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18982_low_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 12 - 334
Target Start/End: Original strand, 43372763 - 43373085
Alignment:
| Q |
12 |
tcatcagattcagagctaagctgtcggcgatcaaaatctatgtcgtccccgccgtcttcagcataggccttttttaacaatggctctcccctaaacttcc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43372763 |
tcatcagattcagagctaagctgtcggcgatcaaaatctatgtcgtccccgccgtcttcagcataggccttttttaacaatggctctcccctaaacttcc |
43372862 |
T |
 |
| Q |
112 |
tcttcctccatggaagtatgctgcgctttgtactttgtgataaataaggctcagaagaagacgtggtagattcatccatatgcgaacgcccggcatcagg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43372863 |
tcttcctccatggaagtatgctgcgctttgtactttgtgataaataaggctcagaagaagacgtggtagattcatccatatgcgaacgcccagcatcagg |
43372962 |
T |
 |
| Q |
212 |
catgcaatagctgtggtaaacccaaatgtctttctcatcacaattcattctcgtgttggaataataagaacatgatcctccagcatttgcagaggccaat |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43372963 |
catgcaatagctgtggtaaacccaaatgtctttctcatcacaattcattctcgtgtttgaataataagaacatgatcctccagcatttgcggaggccaat |
43373062 |
T |
 |
| Q |
312 |
gttccataacggaatgaattccc |
334 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
43373063 |
gttccataacggaatgaattccc |
43373085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University