View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18982_low_47 (Length: 341)
Name: NF18982_low_47
Description: NF18982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18982_low_47 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 1 - 323
Target Start/End: Original strand, 32785233 - 32785555
Alignment:
| Q |
1 |
tttggagatcttactgcacggtcagctgttcgacgacacctctccagtctagctctacatctctgagctggttcaccttcttctgatctcccggaaaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||||||| |
|
|
| T |
32785233 |
tttggagatcttactgcacggtcagctgttcgacgacacctctccagtctagctctacatctctgagctgattcgccttcttctgatcttccggaaaaag |
32785332 |
T |
 |
| Q |
101 |
aggaagctgaaagcaaagacaatagctggttagtactgtatcaagtggaaacattaaaacatccattggcagtttataataaagcactgcagaggtgtta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32785333 |
aggaagctgaaagcaaagacaatagctggttagtactgtatcaagtggaaacattaaaacatccattggcagtttataataaagcactgcagaggtgtta |
32785432 |
T |
 |
| Q |
201 |
cagatcacataccaccattaactgaatacggatatctggaaccggtggcagagctgaagttacgaaactgtgaatccagcatatcctgcaactccattca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32785433 |
cagatcacataccaccattaactgaatacggatatctggaaccggtggcagagctgaagttacgaaactgtgaatccagcatatcctgcaactccattca |
32785532 |
T |
 |
| Q |
301 |
ttagaaattcagtaggcaattac |
323 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
32785533 |
ttagaaattcagtaggcaattac |
32785555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University