View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18982_low_52 (Length: 322)
Name: NF18982_low_52
Description: NF18982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18982_low_52 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 46 - 310
Target Start/End: Complemental strand, 54376781 - 54376517
Alignment:
| Q |
46 |
cattaaccatggcatggaaactgcaacgacgagaagaagagtaacaatgttggtacgtggttagagagagaatcgaacgccacgatctcttctgaaatct |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54376781 |
cattaaccatggcatggaaactgcaacgacgagaagaagagtaacaatgttggtacgtggttagagagagaatcgaacgccacgatctcttctgaaatct |
54376682 |
T |
 |
| Q |
146 |
caacattctctcatttttcgtttgaattttcaccctaattcgtgatggaagcgttgatcgaattatgcgacctcattgcacaaaatccatcgcaattctc |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54376681 |
caacattctctcatttttcgtttgaattttcaccctaattcgtgatggaagcgttgatcgaattatgcgacctcattgcacaaaatccatcgcaattctc |
54376582 |
T |
 |
| Q |
246 |
ggataaactctcgtggatttgcgataaatgtccaccgccggagtatctctccgccggatcgccta |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
54376581 |
cgataaactctcgtggatttgcgataaatgtccaccgccggagtatctttccgccggatcgccta |
54376517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University