View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18982_low_72 (Length: 276)
Name: NF18982_low_72
Description: NF18982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18982_low_72 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 8 - 260
Target Start/End: Original strand, 4573862 - 4574114
Alignment:
| Q |
8 |
gtgatagtgtgagagttttgtatgcaactttagtgtttttctttgttgtgtgttttagatactttttggctgtgccaaaactagatgccactttttcggt |
107 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4573862 |
gtgatagtgtgagagttttttatgcaactttagtgtttttctttgttgtgtgttttagatactttttggctgtgccaaaactagatgccactttttcggt |
4573961 |
T |
 |
| Q |
108 |
gcgacccaccactgtgccctatgactaaccgcatcagaatacgccagcgagtatgacaaccatttcgaagtcgcaacccaccacttggcacaccatgcat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| ||| ||||| |||||||||||||||||| | |||||||||||||||||||||| || | |
|
|
| T |
4573962 |
gcgacccaccactgtgccctatgactaaccgcctcagaatatgcccgcgagcatgacaaccatttcgaagccacaacccaccacttggcacaccacgcgt |
4574061 |
T |
 |
| Q |
208 |
cactactttcttttcgagtgtaccgacacgccttcaccaaatccgcatgtaat |
260 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4574062 |
cactactttcttttcgagtgtacagacacgccttcaccaaatccgcatgtaat |
4574114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University