View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18982_low_75 (Length: 271)
Name: NF18982_low_75
Description: NF18982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18982_low_75 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 11 - 256
Target Start/End: Original strand, 1249209 - 1249452
Alignment:
| Q |
11 |
caaaggatggagggaagttgcaagggtttgatccgtcgtggtttgagaataataagtgtttatgtggtgctcccttggccccttgcaaggcctagttaac |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1249209 |
caaaggatggagggaagttgcaagggtttgatccgtcgtggtttgagaataataagtgtttatgtggtgctcccttggccccttgcaagacctagttaac |
1249308 |
T |
 |
| Q |
111 |
taaagggatgcatgcttaataaatggacttcatgtattattgtgctcttgtttatgcatggagttaagagaaatgcaatctaattataattagtatggat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1249309 |
taaagggatgcatgcttaataaatggacttcatgtattattgtgctcttgtttatgcatggagttaagagaaatgcaatctaattataattagtatggat |
1249408 |
T |
 |
| Q |
211 |
agtctacatgttttaagtacgttctcatcttcttaagtattattac |
256 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1249409 |
agtct--atgttttaagtacgttctcatcttcttaagtattattac |
1249452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 19 - 95
Target Start/End: Complemental strand, 12079037 - 12078961
Alignment:
| Q |
19 |
ggagggaagttgcaagggtttgatccgtcgtggtttgagaataataagtgtttatgtggtgctcccttggccccttg |
95 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||| | ||||||||||||| |||||| |||| ||| ||||||| |
|
|
| T |
12079037 |
ggagggaagttgcaagggtttgatccatcgtcgttttcgcataataagtgtttgtgtggttctcctttgcccccttg |
12078961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University