View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18982_low_78 (Length: 254)
Name: NF18982_low_78
Description: NF18982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18982_low_78 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 11337729 - 11337488
Alignment:
| Q |
1 |
tacattattgaaaccaaatgcagtcgcatctattgattcaaagtattgcactat-aaaaattgtgataaagagatttgtctttgcagttgcatgcggaaa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11337729 |
tacattattgaaaccaaatgcagtcgcatctattgattcaaagtattgcactatcaaaaattgtgataaagagatttgtctttgcagttgcatgcggaaa |
11337630 |
T |
 |
| Q |
100 |
tatcacaaattattgaaaattcagaaagttaagattagataaaa-taaacgaataaaatcaagagtggcaagtacttgtttggtaaaaactcaagagaaa |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11337629 |
tatcacaaattattgaaaattcagaaagttaagattagataaaaataaacgaataaaatcaagagtggcaagtacttgtttggtaaaaactcaagagaaa |
11337530 |
T |
 |
| Q |
199 |
cgacattctatggatccatagataagcttaaagctgtctgtg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11337529 |
cgacattctatggatccatagataagcttaaagctgtctgtg |
11337488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University