View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18982_low_83 (Length: 244)
Name: NF18982_low_83
Description: NF18982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18982_low_83 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 20 - 244
Target Start/End: Original strand, 26544079 - 26544303
Alignment:
| Q |
20 |
cggacaaagtcttggggtcatgttggtcaagaccataaaggtttaaataattttttaaattgctgcaacagcaattgccgtcacaacataaaagattttg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26544079 |
cggacaaagtcttggggtcatgttggtcaagaccataaaggtttaaataattttttaaattgctgcaacagcaattgccgtcacaacataaaagattttg |
26544178 |
T |
|
| Q |
120 |
aagcctcagcaactacaccgagactgcaattgcagccacatcagctatagttgtcttaatttttccatagtacgaaggatcacagttacactacaaccgc |
219 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26544179 |
aagcctcggcaactacaccgagactgcaattgcagccacatcagctatagttgtcttaatttttccatagtacgaaggatcacagttacactacaaccgc |
26544278 |
T |
|
| Q |
220 |
aataaaaaatggtagaaaatggatc |
244 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
26544279 |
aataaaaaatggtagaaaatggatc |
26544303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University