View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18982_low_86 (Length: 237)
Name: NF18982_low_86
Description: NF18982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18982_low_86 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 21 - 219
Target Start/End: Complemental strand, 41472856 - 41472657
Alignment:
| Q |
21 |
tactattgagtttaaagat-tttccatctttgctctttaactaatttctaagacaaatatggcgaataggaccaaaccatgatactttatgctttagaac |
119 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41472856 |
tactattgagtttaaagatctttccatctatgctctttaactaatttctaagacaaatacggtgaataggaccaaaccatgatactttatgctttagaac |
41472757 |
T |
 |
| Q |
120 |
ttcagatattgagaatgactttctgttttagaggtttagttattcagaatgtgtttgcatttatattaatcgattgattatgatgtctttgtaaatatag |
219 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41472756 |
ttcagacattgagaacgactttctgttttagaggtttagatattgagaatgtgtttgcatttatattaatcgattgattatgatgtctttgtaaatatag |
41472657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University