View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18982_low_92 (Length: 229)

Name: NF18982_low_92
Description: NF18982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18982_low_92
NF18982_low_92
[»] chr2 (2 HSPs)
chr2 (95-210)||(37636498-37636613)
chr2 (16-97)||(37636644-37636726)


Alignment Details
Target: chr2 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 95 - 210
Target Start/End: Complemental strand, 37636613 - 37636498
Alignment:
95 attcacgagtgttttatgatttcaagtggggttctgttaatccgctttgtgtccagcttttacctttgccgacctctttttcagctggacagtacatatc 194  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37636613 attcacgagtgttttatgatttcaagtgaggttctgttaatccgctttgtgtccagcttttacctttgccgacctctttttcagctggacagtacatatc 37636514  T
195 agtgtcacacttatat 210  Q
    ||||||||||||||||    
37636513 agtgtcacacttatat 37636498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 16 - 97
Target Start/End: Complemental strand, 37636726 - 37636644
Alignment:
16 attattcttacatgccataaaactcgatgttttgtttttagaggagtttaatatgtgggat-caaataacacttagcaatatt 97  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
37636726 attattcttacatgccataaaacttgatgttttgtttttagaggagtttaatatgtgggatccaaataacacttagcaatatt 37636644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University